Gene putatively regulated by attenuation in B_suis_1330_II
Characteristics of the secondary structures
Terminator: Distance to gene:72 nt. Distance to run of Ts=1 nt. Size=22 nt. Delta G= -7.90 kcal/mol
Antiterminator: Size=49 nt. Delta G= -8.10 kcal/mol
Anti-antiterminator: Size=47 nt. Delta G= -8.70 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
AGAGGCGCCGGCAACCCTGGCCCTGGGAGATGTAATCGATACTCTGGATGTGAATGCG
GGTGAAAAGGCGGTTTCAAAGGACATTATTCATGGCCTTGAACGCAAGCTTATCCAAA
AGCAACTCGGCAACAATAACAGCACCGACCGAGCGCACGGCTGAtggcgtgttccagacttcgtgtt
caaggcttcatgttcaagattggcaggcactctgccgtcatttgttagttttaggcatctccgtttgtgacctccctcatgaaacgccggatatgctcca
tgatcaaggaccagaaaATG
BRA1128 --- BRA1127
Gene: BRA1128 GI: 23500843 BI number: BRA1128 GOG: NOG09790 Description: conserved hypothetical protein
Gene: BRA1127 GI: 23500842 BI number: BRA1127 GOG: NOG08171 Description: conserved hypothetical protei
A
G t ag
T g a g
Cg c c
Gc t t
G | t t
C | gc
A | ta
Cg gt
Gt cg
Cg | t
Gt | t
At | c
Gc ta
| c ta
| a cg
| g a a a
| a gt c c
C c at g t
C t cg gc
At cg at
Gc | c cg
C | | a gc
Cg tg gc
At tg t |
Cg gc tg
Gt ta at
At gc gc
atttgttagttttaggcatctccgtttgtgacctccctcatgaaacgccggatatgctccatgatcaaggaccagaaaATG
..................................................................................................................