                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-31.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTCCAGGTTCAGCAGCAGCTTGGCGTTCAGGCTCTGTCGATCGCCAACTCGTCGAAC
CAGTCGATCCTGTCGCTGTTCCGCGGCTAAtaaaccggaccgtttcaggcaaacagggggggaatatccagcccggcc
agatcggtttggatacttcaggcggggaggacgggcgcggaatgaattccgcgcccgttcttctttttgcccgacatcctgcccgacatcctgtctggca
agccgcaccgcatcctcatcgccactttcgcgcaagcttcgcgcattagcttgcgttcaacaggATG

    fliF --- BRA1145 --- motB Gene: fliF     GI: 23500860     BI number: BRA1146     GOG: COG1766     Description: flagellar M-ring protein FliF Gene: BRA1145     GI: 23500859     BI number: BRA1145     GOG: NOG09792     Description: conserved hypothetical protein Gene: motB     GI: 23500858     BI number: BRA1144     GOG: COG1360     Description: chemotaxis motB protei gc g  g a  g cg tg ta        ga cg       t  a a  g       at t  a       at a  |       gc g  |       gc gc        cg tg        gc tg        cg tg        gc gc        gc |  g       gc gc        cg cg        at tg        gt a  a       gc g  a       at at        gt cg        gc             tttttgcccgacatcctgcccgacatcctgtctggcaagccgcaccgcatcctcatcgccactttcgcgcaagcttcgcgcattagcttgcgttcaacaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NU] COG1766 Flagellar biosynthesis/type III secretory pathway lipoprotein ... can be seen here [N] COG1360 Flagellar motor protein ... can be seen here     ..................................................................................................................