                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:135 nt.     Distance to run of Ts=3 nt.   Size=35 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-14.37 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATGGTTTCGTCGGAAATGCCGGAAGTCCTTGGGATCAGTGATCGTGTTCTCGTCAT
TGGCGAGGGCAAATTGCGCGGCGATTTCCCGAATGAAAATCTTACACAGGAGAAGGTT
CTTGCCGCTGCAATTGGCAAGCCTGCAACCAACGCGGCCTAGtttttgaacatttgtccgcagcgagag
catgtctcccgaaagtggaaaccggtttcgggagacatgcgtaaaaacaaatggttatagcggttccagcggctccgctttaactggaaccgctcttatt
caactggtgcatgacATG

    xylH Gene: xylH     GI: 23500866     BI number: BRA1152     GOG: COG4214     Description: D-xylose ABC transporter, permease protei AT A  C A  T A  T G  A T  C A  A A  C G  A                 AA CG                 C  G CG                  GC |  A                 GC CG                 T  | TA                 T  | TA                 A  | TG                  AT |  G                 CG |  T                 GC |  T                 TA |  C        C       |  A AT       G  A      |  C GT       T  A      |  C CG       C  T      |  A GC        GT       |  A GC        CG       |  C CG        CG        CG GC        GC        GC |  T       TA        CG CG        TA        CG GC        CG        GC                         CTAGtttttgaacatttgtccgcagcgagagcatgtctcccgaaagtggaaaccggtttcgggagacatgcgtaaaaacaaatggttatagcggttccagcggctccgctttaactggaaccgctcttattcaactggtgcatgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG4214 ABC-type xylose transport system, permease component ... can be seen here     ..................................................................................................................