Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:135 nt.     Distance to run of Ts=3 nt.   Size=35 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-14.37 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATGGTTTCGTCGGAAATGCCGGAAGTCCTTGGGATCAGTGATCGTGTTCTCGTCAT
TGGCGAGGGCAAATTGCGCGGCGATTTCCCGAATGAAAATCTTACACAGGAGAAGGTT
CTTGCCGCTGCAATTGGCAAGCCTGCAACCAACGCGGCCTAGtttttgaacatttgtccgcagcgagag
catgtctcccgaaagtggaaaccggtttcgggagacatgcgtaaaaacaaatggttatagcggttccagcggctccgctttaactggaaccgctcttatt
caactggtgcatgacATG

    xylH


Gene: xylH     GI: 23500866     BI number: BRA1152     GOG: COG4214     Description: D-xylose ABC transporter, permease protei


 AT
A  C
A  T
A  T
G  A
T  C
A  A
A  C
G  A                 AA
 CG                 C  G
 CG                  GC
|  A                 GC
 CG                 T  |
 TA                 T  |
 TA                 A  |
 TG                  AT
|  G                 CG
|  T                 GC
|  T                 TA
|  C        C       |  A
 AT       G  A      |  C
 GT       T  A      |  C
 CG       C  T      |  A
 GC        GT       |  A
 GC        CG       |  C
 CG        CG        CG
 GC        GC        GC
|  T       TA        CG
 CG        TA        CG
 GC        CG        GC
                        CTAGtttttgaacatttgtccgcagcgagagcatgtctcccgaaagtggaaaccggtttcgggagacatgcgtaaaaacaaatggttatagcggttccagcggctccgctttaactggaaccgctcttattcaactggtgcatgacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG4214 ABC-type xylose transport system, permease component ... can be seen here

    ..................................................................................................................