Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCGTCCGGTGGAAGCGCGCCATGGCGACACGATCAACGCGGATTTCGGGCCTTACGG
CACCATTGCGTGTCATTTTCTGTAGagtggttccggttaaaacggaatcgctggaaccgctctaaGTGATTGTTT
TGTCGCATTATCCTACGCAAAACCGCTTCGCACTTTTGCTGGAAATGGTCTGGAGCGC
CGTGCGTCCATTTGGACGCACAAAAATCACTCTAACTTTCTGAacttacgcatcgtgctttccaaaaa
tcgatttcgatttttgggctggtgctgaaaggacatttctgATG

    BRA1156


Gene: BRA1156     GI: 23500870     BI number: BRA1156     GOG: COG3836     Description: 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase, putativ



  a
t  a
t  a
g  a
 gc
 cg
 cg
 ta
 ta         c
 gt       c  g
 gc       a  c
 tg        at
 gc        gc
 at        gt
G  |      |  a
A  |       ta
T  |       cG
G  |       gT
 Tg        cG
 Cg        tA
 Ta        aT
 Ta        aT
            GTTTTGTCGCATTATCCTACGCAAAACCGCTTCGCACTTTTGCTGGAAATGGTCTGGAGCGCCGTGCGTCCATTTGGACGCACAAAAATCACTCTAACTTTCTGAacttacgcatcgtgctttccaaaaatcgatttcgatttttgggctggtgctgaaaggacatttctgATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG3836 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase ... can be seen here

    ..................................................................................................................