                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:166 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gattatccccgttcaagcaccacgggcttgcgaccgatccgggagggatataaagatgactaatacattcatatattatgttggcccgttggcgctgtcg
aggcgaaagagtttggtaaaattgccaaacttttatgcgaaaacggcacggcggaccggatggctcggtaaggtcgccttatgcagtacacgtcgcatga
attttttgttggttcgctcaataatgcccccaattgcaccaccgatttcagcgaacaggaaatctttccgaagctgatgctgatgatattctttcagggg
ATG

    BRA1192 Gene: BRA1192     GI: 23500905     BI number: BRA1192     GOG: COG2207     Description: transcriptional regulator, AraC famil   t a  a a  c t  a c  t at gc         c ta       t  g at       g  a |  a       tg g  t       cg a  a       gc at        cg at       g  a ta       g  a at        ta        aa tg        tg       a  t at       |  a       at gt       |  g       tg g  g      |  t       gc g  g      g  t       gc a  |      c  t       ta gc        cg        ta gc        cg        ta gc        gt        gc                         ttttatgcgaaaacggcacggcggaccggatggctcggtaaggtcgccttatgcagtacacgtcgcatgaattttttgttggttcgctcaataatgcccccaattgcaccaccgatttcagcgaacaggaaatctttccgaagctgatgctgatgatattctttcaggggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2207 AraC-type DNA-binding domain-containing proteins ... can be seen here     ..................................................................................................................