                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:116 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtacaagatcacctttctggacccggaagcagcatatcaggtgcagctcaacgtacagatgattatcatggcggtgttcggtggcgcaggcacaattttc
gggccggtcttcggtgcgcttttcctgcaatgggtgtccaactggctctccactgcctataccgacgtggcaggcatgttctttggcatagtcatcgttg
tcgcggtggttttgatgccacgcggccttgccgatctgatgcgcaatctgccgcggcagggctggcgctatttcatcaacaacatgaaggcgaataaact
ATG

    BRA1196 --- BRA1197 Gene: BRA1196     GI: 23500908     BI number: BRA1196     GOG: COG0411     Description: branched-chain amino acid ABC transporter, ATP-binding protein Gene: BRA1197     GI: 23500909     BI number: BRA1197     GOG: COG0410     Description: branched-chain amino acid ABC transporter, ATP-binding protei ac a  t cg cg        ga t  c      c  c g  t       cg t  c       at gt        tg gc       |  g gc       a  c ta        ta a  c       cg at        cg cg        gc gc        ta             tgttctttggcatagtcatcgttgtcgcggtggttttgatgccacgcggccttgccgatctgatgcgcaatctgccgcggcagggctggcgctatttcatcaacaacatgaaggcgaataaactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0411 ABC-type branched-chain amino acid transport systems, ATPase component ... can be seen here [E] COG0410 ABC-type branched-chain amino acid transport systems, ATPase component ... can be seen here     ..................................................................................................................