                                                                        Gene putatively regulated by attenuation in B_aphidicola_Sg

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:206 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=13 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGATTAGCGGCAATTGGAGCTGCAATTGGTATTGGTATTTTAGGTAGTAAATTTTTA
GAAGGAGCTGCAAGGCAGCCTGATTTAGTTCCTTTATTAAGAACACAGTTTTTTGTTG
TAATGGGATTAGTAGATGCAATTCCAATGATTGCAGTTGGATTAGGCTTATATATGCT
TTTCGCTATTTCTTAAtattttatttttttgtaaaaaaattattattttaaattataattaaaatctttacgttttttagacagcgta
aagattaatttttattttaatacataaggtccattatcGTG

    atpF --- atpH --- atpA Gene: atpF     GI: 21672298     BI number: BUsg004     GOG: COG0711     Description: ATP synthase B chain Gene: atpH     GI: 21672299     BI number: BUsg005     GOG: COG0712     Description: ATP synthase delta chain Gene: atpA     GI: 21672300     BI number: BUsg006     GOG: COG0056     Description: ATP synthase alpha chai             A           C  G            GC            GC            AT           |  G           |  A           A  T           C  T   A        GT A  G       TA CG        CG GC        GT TA        AT CG        GC GC        GC             TTTATTAAGAACACAGTTTTTTGTTGTAATGGGATTAGTAGATGCAATTCCAATGATTGCAGTTGGATTAGGCTTATATATGCTTTTCGCTATTTCTTAAtattttatttttttgtaaaaaaattattattttaaattataattaaaatctttacgttttttagacagcgtaaagattaatttttattttaatacataaggtccattatcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0711 F0F1-type ATP synthase, subunit b ... can be seen here [C] COG0712 F0F1-type ATP synthase, delta subunit (mitochondrial oligomycin sensitivity protein) ... can be seen here [C] COG0056 F0F1-type ATP synthase, alpha subunit ... can be seen here     ..................................................................................................................