                                                                        Gene putatively regulated by attenuation in B_aphidicola_Sg

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:103 nt.    Distance to gene:74 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-12.50 kcal/mol
Antiterminator:    Distance from promoter:48 nt. Size=72 nt.     Delta G= -3.23 kcal/mol
Anti-antiterminator:    Distance from promoter:2 nt.    Size=59 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAGG-TATTAT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAGGTTTAGTGAAAGATAGCGTTATTATATTGTCAGCAGAAGGTGAAGATGAAAAA
AAAGCTGTTGAACATTTATCTAAAATAATGACAGAACTAGAATAAattataattgaaaataattttt
tttataaaaaataccggaggttttacattacttccggatttattttataataaataaaatatattcgcctgacattctattttttccctctctaaacaaa
ttttatggttaaggtaatgttATG

    ptsI Gene: ptsI     GI: 21672354     BI number: BUsg061     GOG: COG1080     Description: phosphoenolpyruvate-protein phosphotransferas            tg           t  a           a  a           a  a            ta            at            ta   A        ta A  G       at A  C       At A  T       At A  G      T  t A  T       At A  T       At A  G       Gt G  A       At T  A       Ta A  C      |  t G  A      |  a AT       |  a AT       C  a GT       A  a       ac TA       A  a      t  a GT       G  a      t  t GC       A  t      t  t AT       C  a       ta |  A      A  c       gc |  A       Gc        gt A  A       Tg        at G  A      |  g       gc A  T      A  a       gc C  A      A  g       cg G  A       Tg        cg AT        At       a  | CG        At        ta TA        At        at GC        At        at TA        Ta        at                         attttataataaataaaatatattcgcctgacattctattttttccctctctaaacaaattttatggttaaggtaatgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1080 Phosphoenolpyruvate-protein kinase (PTS system EI component in bacteria) ... can be seen here     ..................................................................................................................