Gene putatively regulated by attenuation in B_aphidicola_Sg

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:151 nt.    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -8.90 kcal/mol
Antiterminator:    Distance from promoter:90 nt. Size=65 nt.     Delta G= -4.14 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaaca-taaact. It has a score value of 76.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaacatttattattaattttttaaactttaaataaattttattcaaatttttgttttttaataaaaaattttgaaaatacatattttttatattttaac
aataaataatctttataattttaaaaaatgttatatatatacaatatttactgtattattcaaagaaaatataatttttaaaaaaccctgattttgggtt
tttttattttaaaagatattaaattgcaagtttgtttttaaatataaaaaaattaaaggattttcaagATG

    hisG --- hisD --- hisC --- hisB --- hisH --- hisA --- hisF --- hisI


Gene: hisG     GI: 21672384     BI number: BUsg092     GOG: COG0040     Description: ATP phosphoribosyltransferase
Gene: hisD     GI: 21672385     BI number: BUsg093     GOG: COG0141     Description: histidinol dehydrogenase
Gene: hisC     GI: 21672386     BI number: BUsg094     GOG: COG0079     Description: histidinolphosphate aminotransferase
Gene: hisB     GI: 21672387     BI number: BUsg095     GOG: COG0131,COG0241     Description: histidine biosynthesis bifunctional protein
Gene: hisH     GI: 21672388     BI number: BUsg096     GOG: COG0118     Description: amidotransferase
Gene: hisA     GI: 21672389     BI number: BUsg097     GOG: COG0106     Description: phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase
Gene: hisF     GI: 21672390     BI number: BUsg098     GOG: COG0107     Description: cyclase
Gene: hisI     GI: 21672391     BI number: BUsg099     GOG: COG0139,COG0140     Description: histidine biosynthesis bifunctional protei


 tt
a  t
t  a
a  c
 at
 cg
 at
 ta
 at
|  t
|  a
|  t
|  t
|  c
|  a
|  a
|  a
|  g
|  a
t  a
a  a
 ta
 at
 ta
 at
 ta
 ta         t
 gt       a  t
t  |      g  t
a  |      t  t
a  |       cg
 at        cg
 at        cg
 at        at
 at        at
 ta        at
 ta        at
 ta        at
 ta        at
            tattttaaaagatattaaattgcaagtttgtttttaaatataaaaaaattaaaggattttcaagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0040 ATP phosphoribosyltransferase ... can be seen here
[E] COG0141 Histidinol dehydrogenase ... can be seen here
[E] COG0079 Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase ... can be seen here
[E] COG0131 Imidazoleglycerol-phosphate dehydratase ... can be seen here
[E] COG0241 Histidinol phosphatase and related phosphatases ... can be seen here
[E] COG0118 Glutamine amidotransferase ... can be seen here
[E] COG0106 Phosphoribosylformimino-5-aminoimidazole carboxamide ribonucleotide (ProFAR) isomerase ... can be seen here
[E] COG0107 Imidazoleglycerol-phosphate synthase ... can be seen here
[E] COG0139 Phosphoribosyl-AMP cyclohydrolase ... can be seen here
[E] COG0140 Phosphoribosyl-ATP pyrophosphohydrolase ... can be seen here

    ..................................................................................................................