                                                                        Gene putatively regulated by attenuation in B_aphidicola_Sg

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.90 kcal/mol
Antiterminator: Size=51 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTCAAGGTTCAAAAACTATATTTGGTGTAATGATTGAAAGTTTTTTAGAAGAAGGTT
TTCAAACAGTTAAAGAAAATCAACCACTAATATATGGAAAATCAATTACTGATGCATG
TTTAAATTGGAAAGACAGTGTCCTTATTATTAAGCAATTAGCAGATGCGGTAGATACT
CGTTTTTAAtaattattgtgtatgctagtcaaaaatttgactagcatctttttattaaactcaacagttgaaattttttaaataatttttaaaa
aataatatttttttaattaaggatctaaaagaATG

    thrS --- infC Gene: thrS     GI: 21672408     BI number: BUsg117     GOG: COG0441     Description: threonyl-tRNA synthetase Gene: infC     GI: 30410815     BI number: BUsg118     GOG: COG0290     Description: translation initiation factor IF-             T           T  T           G  T           C  T   T       T  A A  T      C  A A  A       At CG        Ta GC       A  a A  A       Gt A  |       At TG        Ta TA        Gt AT        Gt        aa TG        Cg       a  t T  C       Gt        at A  G       Tg        at T  G       At        cg T  T      G  a       ta C  A       At        gc CG        Cg        at TA        Gc        ta GT        At        cg TA        Ta        gc GC        Tg        ta AT        At        at                         ctttttattaaactcaacagttgaaattttttaaataatttttaaaaaataatatttttttaattaaggatctaaaagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0441 Threonyl-tRNA synthetase ... can be seen here [J] COG0290 Translation initiation factor 3 (IF-3) ... can be seen here     ..................................................................................................................