                                                                        Gene putatively regulated by attenuation in B_aphidicola_Sg

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:111 nt.    Distance to gene:58 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -8.50 kcal/mol
Antiterminator:    Distance from promoter:67 nt. Size=52 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:    Distance from promoter:67 nt.    Size=18 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCAA-TTTAAT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCAATTTTTGATGGATTTTCATTTAATATATTAATAAAAAAAGCAAAAGAAGCTTT
ATTGTAAaactttattattttttttcaataaataaaacgaggaaattgatctcctttatattttaaatgtaaaacatactaagcttcctttatgg
aagctttttcatattttaaatatatgtatttaaattaaaaatataaaaaaaataggtatataatatATG

    pheS --- pheT --- himA Gene: pheS     GI: 21672411     BI number: BUsg121     GOG: COG0016     Description: phenylalanyl-tRNA synthetase alpha chain Gene: pheT     GI: 21672412     BI number: BUsg122     GOG: COG0072,COG0073     Description: phenylalanyl-tRNA synthetase beta chain Gene: himA     GI: 21672413     BI number: BUsg123     GOG: COG0776     Description: integration host factor alpha-subuni             t           t  a            ta            ta            at            tg            at            ta            ta            ta           c  a           c  c           t  a           c  t           t  a           a  c            gt            ta tg        ta         t t  a      |  g      t  a a  t      a  c      t  t a  c       at        cg at        at        cg gc        gc        ta gc        gc        ta at        at        cg gt        gt        gc                         tttttcatattttaaatatatgtatttaaattaaaaatataaaaaaaataggtatataatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0016 Phenylalanyl-tRNA synthetase alpha subunit ... can be seen here [J] COG0072 Phenylalanyl-tRNA synthetase beta subunit ... can be seen here [R] COG0073 EMAP domain ... can be seen here [L] COG0776 Bacterial nucleoid DNA-binding protein ... can be seen here     ..................................................................................................................