                                                                        Gene putatively regulated by attenuation in B_aphidicola_Sg

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:179 nt.    Distance to gene:21 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G=-23.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TTAAAT. It has a score value of 66.27 and is shown in blue

TTGAAAAAAATATTCAAAATCTCTTAAATATTTCATCTAAGCTAACAGAAATAAATCA
AAAAAAATCAGAAGAAAATCTAAAAAAAGAAGATACATCATCTGAATCAAAAAAAGAT
GAAAACGTTGTAGATGCAGAATTTGAAGAAATAAAAGATCCTAAAAAATAAtaaacttcaat
ctaaaaaaagtcattagagtatttaaaccagcacgggcgtagaaaaaatctacgcccgtgtacttattttgaaagcaggaagaatagcaatATG

    dnaJ Gene: dnaJ     GI: 21672435     BI number: BUsg145     GOG: COG0484     Description: DnaJ protei            a          a  a          a  a           at           gc           at           ta           gc           cg           gc           gc           gc           cg           at           cg           gt             acttattttgaaagcaggaagaatagcaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0484 DnaJ-class molecular chaperone with C-terminal Zn finger domain ... can be seen here     ..................................................................................................................