Gene putatively regulated by attenuation in B_aphidicola_Sg

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:129 nt.    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-10.40 kcal/mol
Antiterminator:    Distance from promoter:71 nt. Size=61 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttcaat-taattt. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcaattactttaaacttttattaatttatatatcaaggatactgcgtcaacaatattaatatctgcttcttatcgtttcttctctaaatagaagaactg
tttttatttattataactaatcataattaatatgagacaatgtatatatttaataaaaacccgctcaaaaataatgcgggttttttatgatataaattta
aggatataaaaaaatATG

    thrA --- thrB --- thrC


Gene: thrA     GI: 21672475     BI number: BUsg188     GOG: COG0460,COG0527     Description: aspartokinase
Gene: thrB     GI: 21672474     BI number: BUsg187     GOG: COG0083     Description: homoserine kinase
Gene: thrC     GI: 21672473     BI number: BUsg186     GOG: COG0498     Description: threonine synthas


  t
t  a
a  a
 at
 ta
 at
 cg
 ta
|  g
|  a
|  c
a  a
a  a
t  t
 cg
 at
|  a
 at
 ta
 at
 ta         a
t  t      a  a
a  t      a  t
t  t      a  a
 ta       c  a
 ta       t  t
 at        cg
 ta        gc
 ta        cg
 ta        cg
 ta        cg
 ta        at
 gc        at
            ttttatgatataaatttaaggatataaaaaaatATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0460 Homoserine dehydrogenase ... can be seen here
[E] COG0527 Aspartokinases ... can be seen here
[E] COG0083 Homoserine kinase ... can be seen here
[E] COG0498 Threonine synthase ... can be seen here

    ..................................................................................................................