                                                                        Gene putatively regulated by attenuation in B_aphidicola_Sg

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:40 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-12.90 kcal/mol
Antiterminator:    Distance from promoter:25 nt. Size=21 nt.     Delta G= -3.42 kcal/mol
Anti-antiterminator:   Size=69 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttttca-tataag. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttttcatgaaaaaagtgttgtagtataagcaatattttatttttattaaaaatagggtgatcttacctaaaaccccgaaatttcggggttttttattata
atctttatttgaaaatttttagtttgaggttgtctaagATG

    nusA --- infB Gene: nusA     GI: 21672641     BI number: BUsg366     GOG: COG0195     Description: N utilization substance protein A Gene: infB     GI: 21672640     BI number: BUsg365     GOG: COG0532     Description: initiation factor IF-   a t  t g  a a  a tg gc ta ta gt ta gt at at |  t |  a at at at at gt ta at c  t t  | t  | t  | ta ta         a        at ta       t  c      a  t ta       t  c       at ta       c  t       gc at       t  a       cg ta       a  a       cg |  g      g  a       cg a  g       ta        cg tg        gc        at at        gc        at tg        gc        at                         tttattataatctttatttgaaaatttttagtttgaggttgtctaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0195 Transcription elongation factor ... can be seen here [J] COG0532 Translation initiation factor 2 (IF-2; GTPase) ... can be seen here     ..................................................................................................................