Gene putatively regulated by attenuation in B_aphidicola_Sg

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:122 nt.    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -6.30 kcal/mol
Antiterminator:    Distance from promoter:60 nt. Size=67 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:    Distance from promoter:36 nt.    Size=38 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TATATT. It has a score value of 75.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAATAAAAATCTCCATAATCTATATTATGAGTGCAAAAATCTTCTAGACAAGAA
AAAACATCTTGATGATTTATTTGATTTTTAGTCAATAAAGACTCAGTAACTAATTCTA
ATGTCATttgaattcactttttaagttaaaattttttattgtatatttattatacaatattttttaaagaaataaacaatattttttatagatat
tattgtataatatctttaaaatttttaataaaaaactctaaatggggatatttatttaagATG

    aroD


Gene: aroD     GI: 21672660     BI number: BUsg386     GOG: COG0757     Description: 3-dehydroquinate dehydratas


            T
          G  C
          T  A
          A  T
          A  t
          T  t
           Cg
           Ta
           Ta
           At
           At
          |  c
          |  a
          |  c
          |  t
          |  t
          |  t
          |  t
          |  t
  T       |  a
T  T       Ta
T  A       Cg
 TG        At
 AT        At
 GC        Ta
T  |      G  a
 TA       A  a
 TA       C  a        t
 AT       T  t      t  a
 TA       C  |      t  t
 TA        At        at
 TA        Gt        ta
A  G       At        at
G  A       At        ta
T  C       At        gc
 AT        Ta        ta
 GC        At        ta
 TA        At        at
 TG        Cg        ta
                        ttttttaaagaaataaacaatattttttatagatattattgtataatatctttaaaatttttaataaaaaactctaaatggggatatttatttaagATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0757 3-dehydroquinate dehydratase II ... can be seen here

    ..................................................................................................................