                                                                        Gene putatively regulated by attenuation in B_aphidicola_Sg

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:176 nt.    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G= -9.80 kcal/mol
Antiterminator:    Distance from promoter:114 nt. Size=79 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:    Distance from promoter:117 nt.    Size=29 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatt-aaaaat. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgattaaattaatttttaatctaaaaaaatgttactaaagattatattaataactttactccttactaaatttaaaaatttagtatgtcttaaaaaata
tattccctaaaaaatactattgatcaatgtattcgttatttatttaaaaaaaattccgataaaatattagagtttttgatttctttcatgaaaaacaaaa
aaatatttactaagaagattttttatttaaatttttttagtattttttataaaattatttcaattaaatgtaggaaaatgaaaATG

    rpe --- trpS Gene: rpe     GI: 21672783     BI number: BUsg518     GOG: COG0036     Description: ribulose-phosphate 3-epimerase Gene: trpS     GI: 21672782     BI number: BUsg517     GOG: COG0180     Description: tryptophanyl-tRNA synthetas            tc           t  a           t  t            cg            ta            ta            ta           |  a           a  a            gc            ta            ta            ta            ta            ta           g  |           a  |           g  |           a  |            ta            ta            at            ta            at            at         a            at       t  t           a  a      t  t   a       t  c      t  t a  a      a  t       ta at       g  a       ta ta       c  a       ta at        cg        at g  t       ta        gt c  a       ta        at cg       a  g       at ta       a  a       gt tg        at        at at        at        at at        at        ta at        at        cg at        at        at at        at        ta                         ttttttataaaattatttcaattaaatgtaggaaaatgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0036 Pentose-5-phosphate-3-epimerase ... can be seen here [J] COG0180 Tryptophanyl-tRNA synthetase ... can be seen here     ..................................................................................................................