                                                                        Gene putatively regulated by attenuation in B_aphidicola_Sg

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:123 nt.    Distance to gene:30 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-10.40 kcal/mol
Antiterminator:    Distance from promoter:100 nt. Size=42 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAAAA-TATATT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAAAATATCAAAATAGACGATTAGATTATATTAAATCTTTTTGGAATGTAGTAAATT
GGGATGAAGCATCTCGTCGTTTGTCCAAATAGtttttaattacttttaatgtataattatttttaatataaatctt
taattaataaatgttttaaaataaaaacatataatatttaatattatatgtttttcattttttatataaatctgaaaatgttaaaggattttttTTG

    pth Gene: pth     GI: 30410817     BI number: BUsg184     GOG: COG0193     Description: peptidyl-tRNA hydrolas aa a  t a  a ta ta         t ta       t  a ta        ta gc        at ta        ta at        at a  a       at at        ta ta        at a  a       ta at        at ta        cg t  t       at at        at at        at ta        at ta        at             cattttttatataaatctgaaaatgttaaaggattttttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0193 Peptidyl-tRNA hydrolase ... can be seen here     ..................................................................................................................