Gene putatively regulated by attenuation in B_aphidicola_Sg

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -4.11 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTAACTCGTCGAGTTGGCGAAACATTAATAATTGGCGATGAAATAACTGTAACAGTA
CTAGGAGTTAAAGGTAACCAAGTTCGCATTGGTGTAAACGCCCCTAAAGAAGTTTCGG
TACATCGTGAAGAAATATATCAACGTATTCAAGCTGAAAAAAAACAAAAAAAAAGTTG
Ataataaatactgcatcttacttactttaggtaagatgcctttttttataagaaaattttttaaaaaaaaattgacttatatcaaaaaaaaagtaaaatt
aaaataataaaaatttcctttagtcaGGT

    _v18 --- _v19


Gene: _v18     GI: BUsg601     BI number: BUsg601     GOG: -------     Description: tRNA-Ser
Gene: _v19     GI: BUsg602     BI number: BUsg602     GOG: -------     Description: tRNA-Ar


 AA
A  A
A  A
G  A
T  A
C  C
G  A
A  A
A  A
C  A
T  A
T  A
A  A
T  A
G  A
 CG
 AT
 AT
 CG
 TA
 At
 Ta         t
|  a      c  t
|  t       at
A  a       ta
T  a       tg
A  a       cg
A  t       at
A  a       ta
 Gc        ta
 At        cg
A  g       ta
 Gc        at
 Ta        cg
 Gt        gc
            ctttttttataagaaaattttttaaaaaaaaattgacttatatcaaaaaaaaagtaaaattaaaataataaaaatttcctttagtcaGGT
    ..................................................................................................................