                                                                        Gene putatively regulated by attenuation in Buchnera_sp

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:195 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=61 nt.     Delta G=-19.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTCAAGAAGTCGAATCAAAATCTGCAGGTGGTATTGTATTAACAGGATCTGCTGCAG
GGAAATCGACTCGAGGAACAGTGACAGCTGTTGGAAAAGGTCGTGTTTTAGATAATGG
AGACATTAAACCATTAGATGTAAAAGTTGGTGATGTTGTTATTTTTAATGAAGGTTAT
GGTGCAAAAACAGAAAAAATTGATAACGAAGAATTATTAATTCTAACTGAAAGCGACA
TTTTAGCAATTGTTGAATAGtaaaccacatgctatatccattgaaaaattgatttaaggggatgtcaaATG

    mopA Gene: mopA     GI: 15616648     BI number: BU019     GOG: COG0459     Description: 60 kDa chaperoni TT A  A TA GC TA TG A  G TA GT GC T  T G  G GC AT        AC CG       G  A GC        TG TA        GC CG        AT TG        CG A  G       AT A  A       AT A  A      |  G A  A      G  G C  |      G  A T  |      A  A A  |      G  A AT       C  A GC        TG CG        CG TA        AT GC        GC AT        CG             TGTTTTAGATAATGGAGACATTAAACCATTAGATGTAAAAGTTGGTGATGTTGTTATTTTTAATGAAGGTTATGGTGCAAAAACAGAAAAAATTGATAACGAAGAATTATTAATTCTAACTGAAAGCGACATTTTAGCAATTGTTGAATAGtaaaccacatgctatatccattgaaaaattgatttaaggggatgtcaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0459 Chaperonin GroEL (HSP60 family) ... can be seen here     ..................................................................................................................