Gene putatively regulated by attenuation in Buchnera_sp

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:153 nt.    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:127 nt. Size=43 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:    Distance from promoter:84 nt.    Size=53 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-CATagt. It has a score value of 75.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAATTTATTAATTTTTTCTTCATagtgttatctctgtatattttaaagaatataatgaaaattaaaaattcaattttt
ttataaatataaacatttgaaagtttaatagatattttttatttaatatataaatattattatattattgaattgtggaaaaataataaataattatata
aaaaattctatttttctattatagaatagaattttgtttttagtatgagaaaattattATG

    cca


Gene: cca     GI: 15616686     BI number: BU061     GOG: COG0617     Description: tRNA nucleotidyltransferas


 at
t  t
a  a
 at
 at
 ta
 at
 ta         t
|  t      a  a
 at       t  t
 ta       t  a
 at       a  a
 at       a  a       at
 tg       t  a      t  t
 ta       a  a      c  a
 ta       a  a      t  t
 at       a  t       ta
|  t      t  t       tg
|  g      a  c       ta
|  t       at        ta
|  g       ta        at
 tg        at        ta
 ta        at        cg
 ta        at        ta
 ta        at        ta
 ta        at        at
 ta        gc        at
 at        gt        at
 ta        ta        at
                        gtttttagtatgagaaaattattATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0617 tRNA nucleotidyltransferase/poly(A) polymerase ... can be seen here

    ..................................................................................................................