                                                                        Gene putatively regulated by attenuation in Buchnera_sp

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=69 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATGTCTAATAGTTTTGGTTTCGGTGGAACTAACGTGTCACTAATAGTAAAAAAATAT
TAAtatactatcaataattgaaatattttttaaaaatctttttctatttaaaaaacatattttttatatatctgactagtattttttaaaaaaatcat
tttaatatttttttgatattaaaatgattttttattcttaatatatattattcagtttatataaaataaaaaatatatttatgaaatctaatttatttat
tttttgatttaaatttttttattgaaaaacaagagagattaaatATG

    talA Gene: talA     GI: 15616714     BI number: BU093     GOG: COG0176     Description: transaldolase ta a  t t  c at tg ta t  c t  t ta tg at ta at c  | a  | at at at at         t at       t  t ta       t  t ta        tg ta        ta a  |       at t  |       ta c  |       at ta        at ta        ta ta        ta ta        ta t  t       ta c  c       at ta        cg at        ta at        at at        at at        at             tttattcttaatatatattattcagtttatataaaataaaaaatatatttatgaaatctaatttatttattttttgatttaaatttttttattgaaaaacaagagagattaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0176 Transaldolase ... can be seen here     ..................................................................................................................