                                                                        Gene putatively regulated by attenuation in Buchnera_sp

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:136 nt.    Distance to gene:51 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G=-12.20 kcal/mol
Antiterminator:    Distance from promoter:78 nt. Size=64 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:    Distance from promoter:39 nt.    Size=70 nt.     Delta G= -5.82 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGTA-TGTAAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGTATAAATACGTAGGGATAAATGGTGTAATTATTGGAATGAAAACATTTGGTGAA
TCTGCTCCAGCAGAAGATTTATTTAAAAAATTTGGTTTTACTGTACAAAATATCTTCA
ATAAATCATTAATTTTATTAAAATCTTAAtttatttaaaaattttaaatatttatggggctcaattatagccccatctt
ttatgaaaaataaaaataatatttatcaatagaaatattaaattaggaaaaaatATG

    dapE Gene: dapE     GI: 15616716     BI number: BU095     GOG: COG0624     Description: succinyl-diaminopimelate desuccinylas   A A  T A  A A  T        A C  C      T  A A  T      T  t T  T      C  t GC       T  t TA       A  a C  A       At A  T       At T  |       At TA        Ta TA        Ta TA       A  a GT        Ta GC        Ta TA       T  t T  T      T  t T  T       At A  A       At A  A       Ta AT        Ta AT       A  a AT       C  t        t AT        Ta       a  t TA        At       a  a T  T       At       c  t T  T       At        ta A  A       Ta        cg TA       A  |       gc TA        At        gc TA        Cg        gc AT        Tg        gc GC        Tg        ta AT        Cg        at                         cttttatgaaaaataaaaataatatttatcaatagaaatattaaattaggaaaaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0624 Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase and related deacylases ... can be seen here     ..................................................................................................................