                                                                        Gene putatively regulated by attenuation in Buchnera_sp

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:106 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAGCTTTTTAGAAGAAGGTTTTCAAACAGTAACGAATAATCAACCATTAATATA
TGGTAAATCGATTACTGATGCCTGTTTAAATTGGAAAGACAGTGTTTTAATTATCGAA
CAATTAGCAGATGCCGTAGATGCTCGTTTTTAAttcacatgctagtcaaaaacacttggctagcattttttcaatt
tttaaaattatttttatagtcagtatataaaaaatatataagtatttttttaatgattgattttttcataggaaaaacaattaatatttttaattaagga
ttaaaagaATG

    thrS --- infC Gene: thrS     GI: 15616745     BI number: BU125     GOG: COG0441     Description: threonyl-tRNA synthetase Gene: infC     GI: 15616746     BI number: BU126     GOG: COG0290     Description: translation initiation factor IF- TC C  G G  T T  T AT GT AT TA        ac G  A      a  a C  t      a  c C  t       at Gc        at Ta        cg A  c       tg G  a       gc At        at Cg        ta Gc        cg At        gc Ta        ta Tg        at             tttttcaatttttaaaattatttttatagtcagtatataaaaaatatataagtatttttttaatgattgattttttcataggaaaaacaattaatatttttaattaaggattaaaagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0441 Threonyl-tRNA synthetase ... can be seen here [J] COG0290 Translation initiation factor 3 (IF-3) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in Buchnera_sp                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-13.70 kcal/mol Antiterminator: Size=42 nt.     Delta G= -6.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGAAAGCTTTTTAGAAGAAGGTTTTCAAACAGTAACGAATAATCAACCATTAATATA TGGTAAATCGATTACTGATGCCTGTTTAAATTGGAAAGACAGTGTTTTAATTATCGAA CAATTAGCAGATGCCGTAGATGCTCGTTTTTAAttcacatgctagtcaaaaacacttggctagcattttttcaatt tttaaaattatttttatagtcagtatataaaaaatatataagtatttttttaatgattgattttttcataggaaaaacaattaatatttttaattaagga ttaaaagaATG     thrS --- infC Gene: thrS     GI: 15616745     BI number: BU125     GOG: COG0441     Description: threonyl-tRNA synthetase Gene: infC     GI: 15616746     BI number: BU126     GOG: COG0290     Description: translation initiation factor IF- TC C  G G  T T  T AT GT AT TA        ac G  A      a  a C  t      a  c C  t       at Gc        at Ta        cg A  c       tg G  a       gc At        at Cg        ta Gc        cg At        gc Ta        ta Tg        at             tttttcaatttttaaaattatttttatagtcagtatataaaaaatatataagtatttttttaatgattgattttttcataggaaaaacaattaatatttttaattaaggattaaaagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0441 Threonyl-tRNA synthetase ... can be seen here [J] COG0290 Translation initiation factor 3 (IF-3) ... can be seen here     ..................................................................................................................