                                                                        Gene putatively regulated by attenuation in Buchnera_sp

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:84 nt.    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.80 kcal/mol
Antiterminator:    Distance from promoter:55 nt. Size=41 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:    Distance from promoter:32 nt.    Size=33 nt.     Delta G= -6.62 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAA-TGAACT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAAATTCTGAGTGAAGTTTATTGAACTCTATAATTTCAGAGGGACATACAAAAGTA
AAATCCATTGGCCAAAAAAATAGTACGGTCGATTGACCATTAGAATACTTTTTAAGAT
CAAATTGCTCAACAATTTGATTGTTTTTTAAAATTGCTGGAGCAATAAAGTTAGGTGC
GTTTTGTGTTACTAAAACCATtttttttcctatagtgttatactagtaaaagaaaattattgttaatttttaatcaacaatggaa
atttaaaataaatATG

    ung Gene: ung     GI: 15616802     BI number: BU183     GOG: COG0692     Description: uracil-DNA glycosylas            AC           T  T            AT            AT   A        GT A  T       AT A  A       TA A  G       TA A  T      A  G        C A  A      C  A      T  A A  C      C  T      C  A CG       A  C       GC CG       G  A       TA GT        TA        TA GC        TA        AT TG        AT        AT TA        GT        AT AT        CG        CG C  T      T  |       TA CG        GC        AT TA        GT        GT                         GTTTTTTAAAATTGCTGGAGCAATAAAGTTAGGTGCGTTTTGTGTTACTAAAACCATtttttttcctatagtgttatactagtaaaagaaaattattgttaatttttaatcaacaatggaaatttaaaataaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0692 Uracil DNA glycosylase ... can be seen here     ..................................................................................................................