                                                                        Gene putatively regulated by attenuation in Buchnera_sp

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:52 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -9.60 kcal/mol
Antiterminator:    Distance from promoter:25 nt. Size=40 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:    Distance from promoter:12 nt.    Size=20 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tagaat. It has a score value of 81.66 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacatctatttacagcctcttcactagaatagctgttctaattattataactagttatgatgtaggcttaaataatctttaaaaacctgctcatactt
aaggcgggtttttttgtgatataaatataaggaattataaaatATG

    thrA --- thrB --- thrC Gene: thrA     GI: 15616813     BI number: BU194     GOG: COG0460,COG0527     Description: aspartokinase I Gene: thrB     GI: 15616812     BI number: BU193     GOG: COG0083     Description: homoserine kinase Gene: thrC     GI: 15616811     BI number: BU192     GOG: COG0498     Description: threonine synthas             a           a  t           t  c            at            at            at            ta            ta           |  a        c           |  a      a  t           c  a      t  t            gc       a  a ta        gc       c  a c  g       at        tg at        tg        cg at        gc        gc ta       t  |       tg at        at        cg tg        gc        cg ta        ta        at at        at        at tg        ta        at                         ttttgtgatataaatataaggaattataaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0460 Homoserine dehydrogenase ... can be seen here [E] COG0527 Aspartokinases ... can be seen here [E] COG0083 Homoserine kinase ... can be seen here [E] COG0498 Threonine synthase ... can be seen here     ..................................................................................................................