                                                                        Gene putatively regulated by attenuation in Buchnera_sp

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTTTTACAATATCTAATTTAGGAGGTATTGGAGGAAGCTGGTTTTCACCAATTATC
AATTCACCGGAAGTAGCAATTCTTGGTATTTCAAAATCTCAGATAAAACCGTCATGGA
ATGGAAAAGAATTTATTCCTTCTTTAATGTTACCATTATCTTTATCTTATGATCATCG
TGTAATAAATGGTGCTTATGCAGCGCGTTTTATTACATTTATTAGTAGAGTTTTATCA
GATATGCATTTTTTAATTATGTAGttttcgctatttcacattacttaaattttttttaagaggtcttaATG

    lpdA Gene: lpdA     GI: 15616826     BI number: BU207     GOG: COG1249     Description: dihydrolipoamide dehydrogenas             C           T  A           A  T AT        GC T  T       TG T  C       AT         T T  C       TG       A  G AT       T  T      T  C AT       C  A       TA GC        TA        CG AT        AT        GC AT        TA        TG AT       T  |       GC A  A      T  |      G  G G  A      C  |      T  T GT       T  |       AT TG       A  |       AT AT        TA        AT AT        TA        TA |  A       AT        AT GC        CG        AT GC        CG        TA TA        AT        GC AT        TG        TA                         TTTATTAGTAGAGTTTTATCAGATATGCATTTTTTAATTATGTAGttttcgctatttcacattacttaaattttttttaagaggtcttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1249 Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide dehydrogenase (E3) component, and related enzymes ... can be seen here     ..................................................................................................................