                                                                        Gene putatively regulated by attenuation in Buchnera_sp

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:122 nt.    Distance to gene:24 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G=-14.20 kcal/mol
Antiterminator:    Distance from promoter:107 nt. Size=19 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:    Distance from promoter:81 nt.    Size=33 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAT-GAAAAT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAATTATTAATAAAAGGTTATCAGGGAAAATGTGTTGGAATACAAAATGAAAAAAT
GGTTTTTAACGATATAAAAAACGCACTAAAAAATATGAAACGTACTTTTAAAAAAGAT
TGGTTGATTACTGCTAAAAAGTTATACTAAtataaaattagtgccggtttcaccggcgctctagtttttaaataaggt
aatataggttttaaaaaATG

    glpF Gene: glpF     GI: 15616916     BI number: BU306     GOG: COG0580     Description: glycerol uptake facilitator protei   A T  A C  A G  A TA CG AT T  T                  t T  A        a       t  c A  T      t  a      t  a G  |      a  a       gc T  |       ta        gc TA        At        cg GC        At        cg GT        Ta        gc TA        Cg        tg TA        At        gc At        Tg        at                         ctagtttttaaataaggtaatataggttttaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0580 Glycerol uptake facilitator and related permeases (Major Intrinsic Protein Family) ... can be seen here     ..................................................................................................................