                                                                        Gene putatively regulated by attenuation in Buchnera_sp

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:33 nt.    Distance to gene:63 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-12.30 kcal/mol
Antiterminator:    Distance from promoter:12 nt. Size=38 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttattt-tataat. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttattttaaaaaaatactaatcttataatattcaacattcctttatttaatgtatcttaaaataagatgaagtgataaaattactataacttcatcttat
tttctaaaaaaataatatttattgcaaaatataattattttccaataatacaggaatgaaatcattATG

    mrsA Gene: mrsA     GI: 15616985     BI number: BU381     GOG: COG1109     Description: MrsA protei   a a  a        t at       a  t ta       a  a ta       a  c cg        at ta        ta at        at tg       g  a g  a       ta t  a       gc a  g       at a  t       at t  |       gc tg        ta ta        at at        gc ta        at ta        at ta        ta             ttttctaaaaaaataatatttattgcaaaatataattattttccaataatacaggaatgaaatcattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1109 Phosphomannomutase ... can be seen here     ..................................................................................................................