                                                                        Gene putatively regulated by attenuation in C_jejuni

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:121 nt.    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.10 kcal/mol
Antiterminator:    Distance from promoter:88 nt. Size=43 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:    Distance from promoter:64 nt.    Size=47 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAT-TACAAT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAATGGCATTTGCGATTTTTTCATTACAATGACCAAAAAGATTGACCCACCAAGAA
CTCACACAATCCATATAAGCTTTATCATCAAAATCATAAAGCCATACACCTTTTGCTT
TTTTTATAGGAATTAAAGGTAGGGTTTCGTGATCTTTCATTTGTGTGCAAGGGTGCCA
AATGTGTTTTAAATCGAGATTTTTTAAGATTTGATTTTGCATtataacttcttttttaaaaatattttg
gcaaaataatactttaaatttttaaatttacaggaaaaaaATG

    bioF --- Cj0305c --- bioC --- modA --- Cj0302c --- modB --- modC Gene: bioF     GI: 15791674     BI number: Cj0306c     GOG: COG0156     Description: 8-amino-7-oxononanoate synthase Gene: Cj0305c     GI: 15791673     BI number: Cj0305c     GOG: COG2830     Description: hypothetical protein Cj0305c Gene: bioC     GI: 15791672     BI number: Cj0304c     GOG: COG0500     Description: putative biotin synthesis protein Gene: modA     GI: 15791671     BI number: Cj0303c     GOG: COG0725     Description: putative molybdate-binding lipoprotein Gene: Cj0302c     GI: 15791670     BI number: Cj0302c     GOG: -------     Description: hypothetical protein Cj0302c Gene: modB     GI: 15791669     BI number: Cj0301c     GOG: COG4149     Description: putative molybdenum transport system permease protein Gene: modC     GI: 15791668     BI number: Cj0300c     GOG: COG1118     Description: putative molybdenum transport ATP-binding protei   T T  T T  A T  T        T TA       G  T TG        GT CG        GC |  A      |  G |  A      |  T G  T      A  G T  T       TA TA        GT TA        GC TA        AT        AG CG        AT       A  G CG        AT        CG AT       T  C       GT C  A       TA        TG A  G       AT        GC T  |       AT       T  | A  |       GT        GC CG       G  G       TA CG        AT        TA GT        TG        TA AT        AT        AT AT        TG        CG                         TGTTTTAAATCGAGATTTTTTAAGATTTGATTTTGCATtataacttcttttttaaaaatattttggcaaaataatactttaaatttttaaatttacaggaaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0156 7-keto-8-aminopelargonate synthetase and related enzymes ... can be seen here [S] COG2830 Uncharacterized protein conserved in bacteria ... can be seen here [QR] COG0500 SAM-dependent methyltransferases ... can be seen here [P] COG0725 ABC-type molybdate transport system, periplasmic component ... can be seen here [P] COG4149 ABC-type molybdate transport system, permease component ... can be seen here [P] COG1118 ABC-type sulfate/molybdate transport systems, ATPase component ... can be seen here     ..................................................................................................................