                                                                        Gene putatively regulated by attenuation in C_jejuni

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:71 nt.    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.00 kcal/mol
Antiterminator:    Distance from promoter:16 nt. Size=61 nt.     Delta G= -5.76 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGAAA-TAAGGT. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGAAATGATTCCTATGATTAGATAAGGTAAATCTGTGATTTCCATagcttttcctaaaaaatatt
aaatatttcaaatacggaataattttatcttattaagctaagtattatcttagtttttttataacaatagaatattttttggtaactttaagcatcgtaa
aaATG

    Cj0344 --- trpE --- trpD --- trpF --- trpB --- trpA --- Cj0350 --- fliN --- Cj0352 Gene: Cj0344     GI: 15791712     BI number: Cj0344     GOG: -------     Description: hypothetical protein Cj0344 Gene: trpE     GI: 15791713     BI number: Cj0345     GOG: COG0147     Description: putative anthranilate synthase component I Gene: trpD     GI: 15791714     BI number: Cj0346     GOG: COG0512,COG0547     Description: anthranilate synthase component II Gene: trpF     GI: 15791715     BI number: Cj0347     GOG: COG0135     Description: N-(5'-phosphoribosyl)anthranilate isomerase Gene: trpB     GI: 15791716     BI number: Cj0348     GOG: COG0133     Description: tryptophan synthase beta chain Gene: trpA     GI: 15791717     BI number: Cj0349     GOG: COG0159     Description: tryptophan synthase alpha chain Gene: Cj0350     GI: 15791718     BI number: Cj0350     GOG: -------     Description: hypothetical protein Cj0350 Gene: fliN     GI: 15791719     BI number: Cj0351     GOG: COG1886     Description: flagellar motor switch protein Gene: Cj0352     GI: 15791720     BI number: Cj0352     GOG: NOG46079     Description: putative transmembrane protei            at           a  a           a  c            cg            tg            ta            ta            at            ta           a  |           a  |           a  |           t  |           t  |           a  |            ta            at            at   T        at T  T       at A  C      |  a GC       a  t TA       a  c GT       t  t       tt Ta       c  t      a  a Cg       c  a      t  t T  c      t  t       gc At       t  t       at At        ta        at At        ta        ta T  t       cg        cg Gc        gc        gt Gc        at        at At        Ta        at                         ttttataacaatagaatattttttggtaactttaagcatcgtaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here [EH] COG0512 Anthranilate/para-aminobenzoate synthases component II ... can be seen here [E] COG0547 Anthranilate phosphoribosyltransferase ... can be seen here [E] COG0135 Phosphoribosylanthranilate isomerase ... can be seen here [E] COG0133 Tryptophan synthase beta chain ... can be seen here [E] COG0159 Tryptophan synthase alpha chain ... can be seen here [NU] COG1886 Flagellar motor switch/type III secretory pathway protein ... can be seen here     ..................................................................................................................