                                                                        Gene putatively regulated by attenuation in C_jejuni

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATATTATCTTTTGGCATATTATTTGCTTTTGCTGTGGCTATAGCACTTCTTAATTTT
GGATTCATATCAGGATCAGTGCCACCTTCTTTAGCGGCTACTTGTATGGCTTTAGCAA
GCTTAGGAAAAAGCTTACTCATTTTATCCCATCTAGCCTCTTTAGAAGCTCTTCGGTA
TTCAAACGCTCGTCCCATaaattctcactttctttaaagatttttaaacttaaaagtataaactaaaaaggctaattaaagctttaa
atggtatgattttaccatttattttcggggagaagctttTTG

    Cj1173 --- Cj1174 Gene: Cj1173     GI: 15792497     BI number: Cj1173     GOG: COG2076     Description: putative efflux protein Gene: Cj1174     GI: 15792498     BI number: Cj1174     GOG: COG2076     Description: putative efflux protei tt a  a a  a ta cg gc gt        at at       g  t at       t  t |  a       at a  a       ta a  a       gc at        gc tg        ta cg        at at        at             tattttcggggagaagctttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2076 Membrane transporters of cations and cationic drugs ... can be seen here [P] COG2076 Membrane transporters of cations and cationic drugs ... can be seen here     ..................................................................................................................