                                                                        Gene putatively regulated by attenuation in C_jejuni

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:108 nt.    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.30 kcal/mol
Antiterminator:    Distance from promoter:86 nt. Size=36 nt.     Delta G= -4.39 kcal/mol
Anti-antiterminator:    Distance from promoter:40 nt.    Size=51 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGTA-TATATT. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGTATTACTTTATTTATGCTTTATATTTCAGGGCTTATGATTACTTTGTTTGCAAA
TAAAAAAGATAGAAGTAAACAATTTGCAGTTCTTGGAGTAGGGGTTGTTGTAACTTTG
CTTTTGGCTTATCTTAGCCTTTGAtttttcctagctttttaagctaggtattatttatttttttgtataatcatactttact
ttattGGA

    tRNA Gene: tRNA-Ser     GI: Cjp25     BI number: Cjp25     GOG: -------     Description: tRNA-Se   A G  G GT TA        TC TG       A  T CG       T  T T  G       TA T  G       CG GT        GC         t AT        GC       t  t CG       |  T       ta GT       |  T       ta T  T      |  T       cg T  G      |  G       gc T  T      |  A       at A  A      |  t       ta A  A      |  t       cg C  C      |  t       cg AT       |  t      t  t AT       |  t      t  | AT       T  c      t  | TG       T  c      t  | GC       T  t       ta AT        Ta        At AT        Cg        Gt GT        Gc        Ta                         tttatttttttgtataatcatactttactttattGGA     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_jejuni                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:108 nt.    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.30 kcal/mol Antiterminator:    Distance from promoter:78 nt. Size=36 nt.     Delta G= -4.39 kcal/mol Anti-antiterminator:    Distance from promoter:39 nt.    Size=53 nt.     Delta G=-12.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGGTA-TATATT. It has a score value of 72.29 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGGTATTACTTTATTTATGCTTTATATTTCAGGGCTTATGATTACTTTGTTTGCAAA TAAAAAAGATAGAAGTAAACAATTTGCAGTTCTTGGAGTAGGGGTTGTTGTAACTTTG CTTTTGGCTTATCTTAGCCTTTGAtttttcctagctttttaagctaggtattatttatttttttgtataatcatactttact ttattGGA     tRNA Gene: tRNA-Ser     GI: Cjp25     BI number: Cjp25     GOG: -------     Description: tRNA-Se   A G  G GT TA TG        TT CG       T  G T  G      T  G T  G       CC GT        GT AT        TT         t CG        TA       t  t GT       |  T       ta T  T      |  C       ta T  G      |  T       cg T  T      |  T       gc A  A      |  A       at A  A      |  G       ta C  C      |  C       cg AT       |  C       cg AT       |  T      t  t AT       |  T      t  | TG       T  T      t  | GC       C  G      t  | AT       A  A       ta AT        At        At GT        Tt        Gt AT        Gt        Ta                         tttatttttttgtataatcatactttactttattGGA     ..................................................................................................................