                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-24.30 kcal/mol
Antiterminator: Size=22 nt.     Delta G=-10.50 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-11.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTTCGCCTCGTGGGCGGTCAGCACGGGCGTTGATCTTCAGCTCAACATCCAGAACCT
GACGGACGAGCGCTATATCGCCCGCACCAACGGCGTGCACCACGCCGATCCGGCGCCG
GGTCGCCAAGCGATCCTAACCATCAATGTGAAGTACTGAtcctcccccttagggtgcttcacacccagcgc
cccgtccgacctgtgtcggtcggggcgtttttcctttttggtcagacgatgatctgatccggatcaaaggaagacgcggccgatccagataggaacggct
cgcaactaggacaTTG

    CC0027 Gene: CC0027     GI: 16124283     BI number: CC0027     GOG: COG3128     Description: conserved hypothetical protei   c c  c c  t c  t ta cg                  tg cg                 c  t t  |                 cg A  |                 at G  |       ca        gc T  |      a  c       cg Cg       c  c       cg At       t  c      t  t Tg        ta        gc Gc        cg        cg At        gc        cg At        tg        cg Gc        gc        cg Ta        gc        gc Gc        gc        cg                         tttttcctttttggtcagacgatgatctgatccggatcaaaggaagacgcggccgatccagataggaacggctcgcaactaggacaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3128 Uncharacterized iron-regulated protein ... can be seen here     ..................................................................................................................