                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-21.40 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-16.20 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -8.54 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTACGGCGGGTTTACGCCGACGGCGATCTTGGACAGGTCCATtttgactctttatcagatgcggccctt
ggggagcggcctgcgcggctgggcttataggcccaaaatgctgcggcgcggaagacgactccggagatttccccgccatgagtcgacaacgaccgccaat
tcgcctacaaagcgttccacatcgtccgttagcgctagatggcgctttcgagcggcggcccgaaaggctgccgctttttgtttggccgaacggtctcagc
gccgccggcccagaacttgagttgagagaccGTG

    CC0046 --- CC0045 --- CC0044 Gene: CC0046     GI: 16124302     BI number: CC0046     GOG: -------     Description: hypothetical protein Gene: CC0045     GI: 16124301     BI number: CC0045     GOG: COG0779     Description: conserved hypothetical protein Gene: CC0044     GI: 16124300     BI number: CC0044     GOG: COG0195     Description: N utilization substance protein   c a  a t  a c  a cg gc cg |  t |  t       ga t  c      a  t t  c       tg a  a       cg a  c       gc c  a       cg c  t       gc gc        at cg       t  t       aa c  t      t  t      g  a a  c       gc        cg gc        cg        cg cg       c  a      c  | at       t  g       gc at        gc        gt c  a       cg        cg a  g       tg        gc gc       a  c       gc cg       c  |       cg t  |      a  |       gc gc        cg        at at        cg        gt                         tttgtttggccgaacggtctcagcgccgccggcccagaacttgagttgagagaccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG0195 Transcription elongation factor ... can be seen here     ..................................................................................................................