Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:4 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=14 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCACTGAGCGTCCTCGCCCTTGGTCACCGTGAGAAAGTCGGGGCCGAAAAACACCC
GCGACACATCGCCAAGCTCGAACAGCGCCTTGGCCAGCGGCGAGGCGTCGCCCTCCTC
CGGCGTGCGAAACTCGCGCGCGCCGTCCCCCAGCACTTCACGGCCGGGAAGGAACTTC
AGGACCTCAGGATTGGGGGTGGTTTCGGTCTGGATAAACATGCGCCTGAAATGGACCT
CGCGACGTCGTGACGCAAGGGCGCCGAAAGCGCGCATTTTAAAAGTGACACAGGCGTC
ATTTTCTGGCGTG

    CC0063


Gene: CC0063     GI: 16124318     BI number: CC0063     GOG: COG2124     Description: cytochrome P450 family protei


                      T
                    T  T
           AG       T  A
          A  G      A  A
           CG       C  A
           GC       G  A
           CG        CG
          A  C       GT
          G  |       CG
          T  |      G  A
           GC       A  C
           CG       A  A
           TA       A  C
 CG       G  A      G  A
A  T      C  A       CG
 GC       A  G       CG
 CG        GC        GC
 GT        CG        CG
 CG        GC        GT
 TA        CG        GC
                        ATTTTCTGGCGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[Q] COG2124 Cytochrome P450 ... can be seen here

    ..................................................................................................................