                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G=-13.10 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-12.00 kcal/mol
Anti-antiterminator:   Size=64 nt.     Delta G=-24.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAAGCCCCTTGTCCTCGTAGAAGCGCAGGGCGCGGGGCGTGGCTTTGAATTCATTGC
ACAGCTGGCGGATCGTGAAGGTCCGCTCGGGGCGTCGCAGGTCGGCCATggatggaaacctccc
aaggaagagggcccggctactgcggcccggccgctttgttatcgctgatcaccctaaacccgatctcgtgacgtcgtcaacgcttacgtaaacgtcaact
gtaaggcaggcgataggtttactttcctagccccgctggcgtacccttctcggcgaaggccgactggaggaggagccgATG

    CC0082 Gene: CC0082     GI: 16124337     BI number: CC0082     GOG: COG2932     Description: hypothetical protei   T C  C G  G CG CG TG GC G  G       ag A  |      a  g AT       c  a GC       c  a TG        cg GC        ta |  A       cg CG        cg TG       a  g AT       a  | GC       a  | G  G       gc CG        gc GC       t  c GC       a  | TA       g  | C  |      g  | G  |      T  |        t A  |      A  |      c  g C  |       Cg       a  c AT        Cg        tg Cg        Gc        cg G  |       Gt        gc Tg       C  a       gc Ta       T  |      c  c At       G  |       cg Cg        Gc        cg Tg        At        gc Ta        Cg        gc                         gctttgttatcgctgatcaccctaaacccgatctcgtgacgtcgtcaacgcttacgtaaacgtcaactgtaaggcaggcgataggtttactttcctagccccgctggcgtacccttctcggcgaaggccgactggaggaggagccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2932 Predicted transcriptional regulator ... can be seen here     ..................................................................................................................