                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-18.10 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -4.42 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-27.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGTGGTCGGCGCGGTGATCGTGGTCGGCTCCACGCTGTTCATCTCCTGGCGAGAGCA
CCAACTTGCCAAGCAGGCTGCGGCCGAACCGACCTAGagcttggacgccgtcgccggcgcgtggtggcgaaag
cgcgcgcgtcctttcgcgcgccgatcaaacccgccagagccctttttggacccatcaggccgcataaaagggctctttttcaaaagtttagagccctctt
cgatccgatagccgtttcacacccgtcggaaaatgctctagccatggcgcgctgctcttagggacctcgATG

    CC0092 Gene: CC0092     GI: 16124347     BI number: CC0092     GOG: COG1087     Description: UDP-glucose 4-epimeras aa g  a cg gc g  g t  | g  | gc        aa tg       c  a gc       t  c        t cg       a  c      a  c gc        gc       c  a cg        cg        cg gt       |  c       cg gc       |  c      a  | c  c      |  a       gc c  t      c  g       gc g  t      g  a       tg c  t       cg       |  c t  |       gc       |  a gc       |  c      |  t cg       c  c       ta |  c      g  t       ta cg       c  t       ta gc       t  t       ta cg       t  t       cg a  |      t  t       cg gc        cg        cg gc        cg        gc tg        ta        at ta        gc        gc                         tttttcaaaagtttagagccctcttcgatccgatagccgtttcacacccgtcggaaaatgctctagccatggcgcgctgctcttagggacctcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1087 UDP-glucose 4-epimerase ... can be seen here     ..................................................................................................................