                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-29.10 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAGACCACCCTGGACGCCGAAGCGCGCACCTTGCTGCAGGTCCGCGTCAACCACGCC
GACGACGCCGACGACATGTTCAGCCGCCTTATGGGTGACTTGGTCGAGCCGCGCCGAG
AGTTCATCCAGGAGAACGCCCTCGACGCCGAGGTCGACGTCTAAagctcatccttgcagctaagtgt
tgttgcaagtgtttgttccataagcgccgggcgcccaatccaggggcggcccggcgttttcttttccagaaacgcccgtctcgccttggccgcgggcccc
agtcgcttcgcgtcgccGTG

    CC0161 Gene: CC0161     GI: 16124416     BI number: CC0161     GOG: COG0840     Description: hypothetical protei            tg           g  t            at         c            at       t  c            cg       a  a            gt       a  g           t  t       cg           t  c       cg            gc        cg            ta        gc gt       |  t      |  g a  g      |  a       cg a  t      |  a       gc t  t       tg        gc cg        gc        gc gt        tg        cg at        gc        cg cg       a  c       gc gc       a  g       cg ta        tg        gt ta        cg        at cg        gc        at                         tcttttccagaaacgcccgtctcgccttggccgcgggccccagtcgcttcgcgtcgccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_crescentus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:100 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G=-10.10 kcal/mol Antiterminator: Size=17 nt.     Delta G= -3.30 kcal/mol Anti-antiterminator:   Size=55 nt.     Delta G=-12.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGAGACCACCCTGGACGCCGAAGCGCGCACCTTGCTGCAGGTCCGCGTCAACCACGCC GACGACGCCGACGACATGTTCAGCCGCCTTATGGGTGACTTGGTCGAGCCGCGCCGAG AGTTCATCCAGGAGAACGCCCTCGACGCCGAGGTCGACGTCTAAagctcatccttgcagctaagtgt tgttgcaagtgtttgttccataagcgccgggcgcccaatccaggggcggcccggcgttttcttttccagaaacgcccgtctcgccttggccgcgggcccc agtcgcttcgcgtcgccGTG     CC0161 Gene: CC0161     GI: 16124416     BI number: CC0161     GOG: COG0840     Description: hypothetical protei CG A  C GC CG TA CG CG C  T GC CG |  A |  C A  G AT GC AT G  A G  A A  | C  | C  |                 gt T  |                a  g A  |                a  t C  |       cc       t  t Ta       t  t       cg Tg        at        gt Gc        cg        at At       |  c       cg Gc        ta        gc |  a       cg        ta At        gc        ta Gc        at        cg                         tgtttgttccataagcgccgggcgcccaatccaggggcggcccggcgttttcttttccagaaacgcccgtctcgccttggccgcgggccccagtcgcttcgcgtcgccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................