Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:211 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=16 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgtaatcccaacctcaaaaaatgaactccaattcgagttccaagtcgaatctgtcaaaaaagcttctcactttcgtgatagaatattttccctcataat
attcggccacgaatagtgaatctaattcggccctggattcccgcagatggggaatcctctctatcgtaagaagtgcaacgctcaggcgccttgtattgag
cgccgactgttccgcaaaaactgtcacaattgccgactaaacacccccggaggcttgatcgcctgcgttcgtcgcggcttgagaaaccagaggggctcct
GTG

    CC0170


Gene: CC0170     GI: 16124425     BI number: CC0170     GOG: NOG04043     Description: hypothetical protei


                      c
                    t  t
            t       t  c
          c  g      c  a
          t  t       gc
           Gc        at
           Ta        at
          G  a       at
          t  a      a  c
 gc       c  a      a  g
g  t      c  a       at
 gc        ta        cg
 gc        cg        ta
 at        gc        gt
g  G       gt        ta
 aT        gt        cg
 cG        gc        ta
                        atattttccctcataatattcggccacgaatagtgaatctaattcggccctggattcccgcagatggggaatcctctctatcgtaagaagtgcaacgctcaggcgccttgtattgagcgccgactgttccgcaaaaactgtcacaattgccgactaaacacccccggaggcttgatcgcctgcgttcgtcgcggcttgagaaaccagaggggctcctGTG
    ..................................................................................................................