                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-27.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-14.00 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-13.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGCCTTCACCTCGACGCTCAACGCCTTTGTCAACGGCGCCAACGAGCTGGCCGTCGC
CGTGTTCAACGCCACGGGTCTGGGCGCCTTCTTCGGCGCCACCACCTACATCGGCGCT
GTCCGCGACAGCAACGACACTTGGTACGCCGGTTGGACCTGCAACAGCGGCGCGGCGA
ACTTCGGTTCGACCAGCACCGCCTGCACGTCGCTGCCGACCAACTAAgacgacgcgacttcgtcg
aagcggggggcggctggaacacagctgccccccatttttacctgcctagctccccgggggaTTG

    CC0171 Gene: CC0171     GI: 16124426     BI number: CC0171     GOG: COG1629     Description: TonB-dependent recepto             g           c  a           g  c           c  t   G        at C  C       gc C  C       cg AT        at CG        gc         a GC       A  g      a  c A  A      A  a      g  a C  C       Ta        gc CG        Cg        ta AT       A  c       cg GC       A  g       gc CG        Cg        gt |  C       Cg        cg T  T      |  g       gc TG       |  g       gc GC       A  g       gc GC        Gc        gc CG        Cg        gc TA        Cg        gc                         atttttacctgcctagctccccgggggaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1629 Outer membrane receptor proteins, mostly Fe transport ... can be seen here     ..................................................................................................................