                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:180 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-12.34 kcal/mol
Antiterminator: Size=27 nt.     Delta G=-14.50 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGCCGGTCAGCGCGCCCGTGCCGGTGTTGTTACGGACCGGCATGCCCGTATAGGGA
TCGGTGGTGGTGCAGGCGGCCAAGGCGCCGGCGCTCATCAGCACCACCGCCAGCGTCA
TTTTTCGAGCGAATTTCGGCATggtcgcaaccctcgcatctttgttgtagatcaagtcacccgggcaaacgcccgtcttatggt
caagttcccgaccacaacgccgcccggaaacgaacagccttcgtttcgaccagcgtccggtgtagtaagaaggaacttactcattccaaggctcgcagac
GTG

    CC0200 Gene: CC0200     GI: 16124455     BI number: CC0200     GOG: COG3491     Description: oxidoreductase iron/ascorbate famil                      AG                     C  C                     T  A            AA       A  C           C  G      C  C            CG       T  A            GC       C  C           G  |       GC CA        CG        CG G  G       GC        GC TG        GC        GC GC       A  G      C  A G  G       CG        CG TG        GC        GC GC        TG        CG GC        GC        GT TA        GT        GC                         ATTTTTCGAGCGAATTTCGGCATggtcgcaaccctcgcatctttgttgtagatcaagtcacccgggcaaacgcccgtcttatggtcaagttcccgaccacaacgccgcccggaaacgaacagccttcgtttcgaccagcgtccggtgtagtaagaaggaacttactcattccaaggctcgcagacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3491 Isopenicillin N synthase and related dioxygenases ... can be seen here     ..................................................................................................................