                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:63 nt.     Distance to run of Ts=2 nt.   Size=33 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-24.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGCTCGCTCTCGATGTCGATCACGAAGTCGGGATAGATCTCGTAGAGATCCTTGAAG
GTGACGCCGGAAAGGCCCTTGGCCGCCTTGGCCAGAGCCCGATTGGCGCGAGACCGTT
CAAGCGCCGGATGGGCCAGCACCAAAAGCACGCCCGAGGTGGCGGGCGTCATctggccggt
gctagcgttcgtcatcaagcagcccttcgggaaaataattcatcaagggttgaatttattcgcggctcgggcgacacgctgcgcccagcgccagacgtat
aagtctgggaacagggagacaccATG

    CC0206 --- CC0207 Gene: CC0206     GI: 16124461     BI number: CC0206     GOG: COG1788     Description: 3-oxoadipate CoA-transferase, alpha subunit Gene: CC0207     GI: 16124462     BI number: CC0207     GOG: COG2057     Description: 3-oxoadipate CoA-transferase, beta subuni GT G  G A  G GC CG CG CG        tc GC       g  a CG       c  t AT       t  c |  C      t  a |  A      g  a        t C  T       cg       a  a Gc        gc       a  a At       a  |       at |  g       ta        at A  g       cg        gc A  c       gc       g  a A  c      t  |      g  t Cg        gc       c  c Cg        gc        ta At       c  t       ta Cg       c  |       cg Gc        gt        cg At        gc        cg C  a       tg        gt Cg        cg        at Gc        Tg        cg                         aatttattcgcggctcgggcgacacgctgcgcccagcgccagacgtataagtctgggaacagggagacaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1788 Acyl CoA:acetate/3-ketoacid CoA transferase, alpha subunit ... can be seen here [I] COG2057 Acyl CoA:acetate/3-ketoacid CoA transferase, beta subunit ... can be seen here     ..................................................................................................................