                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-24.40 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-20.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACGAAGTCGGCGCTCCGGTGGGCGAACCCGTCACCGTCGCCGAGTATTTCGGTGTC
TCGGAAGAGAAGCTGAACGGCCTGTCGGCTGAGAAGCTGAAAGAGCTGCAAGAGAATG
GCGCCCTGGCTCAGATCTACGCGCACCTCGTTTCGCTGCTCGGCTGGGACCGCCTGAT
CAACAAGACGATGATGAAGCAGGCTGAAGCCGCGAACCTGAACTGAggttcagcgtcagctgaaat
cgaagagggcggcgggctggacccgtcgccctttttctttggccggtttagcgcgcgaaaATG

    CC0216 Gene: CC0216     GI: 16124471     BI number: CC0216     GOG: -------     Description: hypothetical protei AC A  T G  G TA Cg Cg At At Gc |  a Cg Gc Cg C  | G  | A  | At         a         g Gc       a  g      t  g Ta       g  a      c  a Cg        cg        gc Gc        tg        gc Gt       a  g       gc A  g      a  |       cg C  a      a  |       gt G  a       gc        gc A  |       tg        cg A  |       cg        gc G  |       gc        gc Ta       a  g       gc At        cg        at Gc        tg        gt Tg        gc        at                         ttctttggccggtttagcgcgcgaaaATG     ..................................................................................................................