Gene putatively regulated by attenuation in C_crescentus
Characteristics of the secondary structures
Terminator: Distance to gene:53 nt. Distance to run of Ts=0 nt. Size=23 nt. Delta G= -9.30 kcal/mol
Antiterminator: Size=49 nt. Delta G=-12.30 kcal/mol
Anti-antiterminator: Size=59 nt. Delta G=-13.62 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
AGGCCTGCTTGGAGAGATCCAGGTGCAGGCCGGCGACGTCCAGGGTCAGAGCGTCAAG
GCGTCCCGGCTCGGCGTCGAAGAACTCGACGATACGCTTGTCGCCCGCAGCCTTGGCG
GCGGCTTCCAGGCGGGTCCAGGCGGCGTCGAGATCGGCCATgtcgtcctcacaggtttggtaaatcgctg
tttacggacccgggcttatcaaacaggcgccgccgcgtcatggcagaccaatgacgttttttgcgggagcccccgatgtcctgtgacgccgtcgcctttt
ccgccatgctctggATG
CC0221
Gene: CC0221 GI: 16124476 BI number: CC0221 GOG: ------- Description: hypothetical protei
t
g a
g a
t a
t t a
t c c a
g g t a
gc a c
at ta
cg tg
at cg
| t gc
| t | g
c a gc
t c gc
cg cg
cg | c
ta | c
gc | g
c c c c
t | cg ag
gc at c a
Tg gc gc
A | g a gc
Cg c t | a
Cg a | ta
Gc t | at
Gt tg cg
C t tg ta
Ta gc gc
At ta cg
Gc cg gt
tttttgcgggagcccccgatgtcctgtgacgccgtcgccttttccgccatgctctggATG
..................................................................................................................