                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-19.90 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-22.46 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-28.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGACCGAGTATTCCAAGGCCGCCACCAAGGGTCAGTGGCACGGCTCGGACGGCGTC
TGGACCAGCTTCGACGAGATGATGAAGAAGCGCTCGGCCGAAACGATCCCGGCGGAAT
GAtgttgggcgtcttctcccccttgcgggagaagagcttgccccggacttgatgcggggtgtcagcgaagctgacggatgaggggtttcccggcgtcgc
ccgcgcgacccctcacccggcccggcgagggccgggccaccctctcccgcaaggggagagggttttgttttgagcggagcatcccATG

    CC0261 Gene: CC0261     GI: 16124516     BI number: CC0261     GOG: COG1893     Description: conserved hypothetical protei tc g  g c  c gc gc         c cg       g  g c  c      g  a c  g       cg t  c       cg tg        cg ta        gc gc        gc gc        cg gc        cg gc        cg at       |  c gc       a  c        a ta       c  a      c  a a  c      t  c      g  g gc       c  c       cg gc       c  c       cg cg       c  t       cg |  g      c  c       ta |  c       at        cg a  c       gc        ta gc       c  c       cg tg        gc        cg cg        cg        cg gc        gc        at                         tttgttttgagcggagcatcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1893 Ketopantoate reductase ... can be seen here     ..................................................................................................................