                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-29.10 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-14.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-26.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCATTGGCAAGGATCACACCCTCTTCGCGCTCGTCCAGGGCGCGGTGGGCTTCGTG
ACCAAGAAGCACAATCGCACCTACGTGACCGTGACCCCGGCCGCTCAGCCGGCCGAGT
AAgcacgaaccaggtttctttcgggtcgtgcttcgcaagaagacgatccggacagacgatctctagcggggagtccggacgccgggctccccgcttttg
ttttgtcgcgccgctgaaacaggcttggccatggcggtgtcacggtcccggatgaaagagggccggagaaacctgggaggcgccgATG

    CC0317 Gene: CC0317     GI: 16124572     BI number: CC0317     GOG: COG1670     Description: acetyltransferase, GNAT famil ca g  a cg ta ta         g cg       a  c g  |      t  g ta        cg gc        tg cg        cg ta        ta gt       a  |        c gc       g  |      a  g gc       c  |       gc cg       a  |       gc tg       g  |       cg ta       a  |       cg |  c       cg        tg ta        at        gc cg        gc        at ta        gc        gc |  c       cg        gc tg        cg        gc ta        ta        gc gt       a  |       cg gc        gc        gc at        cg        at                         tttgttttgtcgcgccgctgaaacaggcttggccatggcggtgtcacggtcccggatgaaagagggccggagaaacctgggaggcgccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1670 Acetyltransferases, including N-acetylases of ribosomal proteins ... can be seen here     ..................................................................................................................