                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=25 nt.     Delta G=-19.00 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-12.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAGCACGAACGGCAGCCAGTGAGTCGGCAGCGCGGCGTGCAGAAAGGCGACCGCAAA
GGCGGTGACGGCGATCGAGGCGAAGAAGGGCGAGGTCACggaagggcatatagcgtgttataaagtaacat
tccagagggtacccgccctcttgtgtgctttcgtcgcgcgcctcggctgaatccgccgctacgccgttgactcccgagccttgggctgtataagtcgcgc
cctcttcgcccgccgggtttccgagcgggcgttccctattttgcgaacgcacgtttttaaggcgctaacctATG

    CC0319 --- CC0318 Gene: CC0319     GI: 16124574     BI number: CC0319     GOG: COG0261     Description: ribosomal protein L21 Gene: CC0318     GI: 16124573     BI number: CC0318     GOG: COG0211     Description: ribosomal protein L2   g c  c t  g g  c a  c a  c t  t a  c t  t g  t t  c cg                  tt gc        tt       a  t gc       g  t      t  t gc        gc       c  g t  |       gc       c  c t  |       cg        cg c  |      |  a       ta cg        cg        ta gc        gc        gc a  |       cg        cg gc        cg        gc cg        cg       g  a cg        gc        gc cg        cg        cg                         tttttaaggcgctaacctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0261 Ribosomal protein L21 ... can be seen here [J] COG0211 Ribosomal protein L27 ... can be seen here     ..................................................................................................................