                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-24.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-22.61 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAGCAGCCCCTGCCGCTGCTGGACCAGAAGGCCTTCACCCTGGTGGACCTGACGGCC
CAGTGGACCGCTCCGAGCGGCCGCTACAAGCTGGCCCTGACCGGCAAGAACCTGACCA
ACGAGAAGTACCGCATCGGCGGCTACAACTTCGGGGTCCCGACCTACAACAACTCGGT
GATCGGCTTCTACGGTCCGCCGCGCACTGTGGCCGCTTCGATCGAGGTGGCCTTCTAA
tctaggcgatagctgctcgggcgggacttgctgcaacaggtcccgccctttttgtatctgtacgggcgTTG

    CC0336 Gene: CC0336     GI: 16124591     BI number: CC0336     GOG: COG0477     Description: major facilitator family transporte AT G  C        a CG       t  g TA       a  c TG        gt CG        cg GT        gc CG        gt CG       a  c GC       t  g GC        cg        gc |  T       tg       t  a T  T      A  c      c  a G  C      A  g       gc T  T       Tg        ta C  A       Cg        tg A  A       Ta        cg C  t      |  c       at G  c      T  t       gc C  t      C  t       gc G  a       Cg        gc Cg        Gc        cg Cg        Gt        gc Gc        Tg        gc Cg        Gc        gc                         tttttgtatctgtacgggcgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................