                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-24.70 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=71 nt.     Delta G=-38.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGTACGCCATCCAGATCACGGTCGCCGACGTGCGCGACGGCGCCTGCAGCTCGTCGA
CGCTGAAGGAAGCCGCCTCGTGGGGCAAGGTCTCGACCACCTACGAACAGATGGTCTT
CGCCGAGGCCACCACGGTTGTCCCGCTGATCGCCTCGGACGCCTACTGGCGCAAGGCC
TGGGAAGGCCGCGAAAAGCCGCGCTGGAACAAGCTGTTCGGCAAGTAAgcctgacggtccggcg
ggcttgatcggccggagttgaaaatgcagggtccccgaaagtgatttcggggaccctttttcATG

    CC0358 --- CC0357 --- CC0356 Gene: CC0358     GI: 16124613     BI number: CC0358     GOG: COG0671     Description: acid phosphatase Gene: CC0357     GI: 16124612     BI number: CC0357     GOG: COG0735     Description: Fur family protein Gene: CC0356     GI: 16124611     BI number: CC0356     GOG: COG0824     Description: hypothetical protei GT A  A A  A Cg Gc Gc C  t Tg Ta Gc Tg Cg Gt A  | A  | C  |       gg A  |      c  a A  |       cg Gc        gt Gc        gt Tg        cg Cg        ta Gc       |  a Cg       |  a G  |      |  a Cg       |  t       tg Cg       |  g      g  a Gc       a  c       at At       g  a       at At        tg        at A  g       tg        gc A  a       cg        cg G  t       gt        cg C  |       gc        cg Gc        gc        cg Cg       c  |       ta Cg        gc        gc Gc        gc        gc Gc        cg        gc                         tttttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0671 Membrane-associated phospholipid phosphatase ... can be seen here [P] COG0735 Fe2+/Zn2+ uptake regulation proteins ... can be seen here [R] COG0824 Predicted thioesterase ... can be seen here     ..................................................................................................................