                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-25.90 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-17.90 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-14.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATCATCGGCGCCGGCGGCATCGGTCAGATTCTGTACGACTCGATCAACGCGTTCCAG
TTCGACCAGACCGGCTGCATCGTGCTGGTCATCGTCGTAGCGGTCTCGATGATCGACC
TGCTGTCACAGGTCATCCGCACGCGCCTACTCTGAtcagggccgccgcatcggcgggcgaagtccatagaaagg
cgccgcggctctaggagccgcggcgtttttctttgtatagtggtcgagcagggcccttgcgcccccgccgcagtcgccgtccgacgacgcgtccctgacc
ctgaagggccATG

    CC0364 Gene: CC0364     GI: 16124619     BI number: CC0364     GOG: COG1253     Description: CBS domain protei At         a G  c      g  a Ta        cg Cg        gt Tg        gc Cg        gc A  c      c  a T  c      g  t C  g      g  a C  c       cg         a Gc        ta       t  g Cg       |  a       cg Gc       |  a       ta |  a      a  g       cg |  t       cg        gc C  c       gc        gc A  g       cg        cg Cg       |  c       gc Gc       |  c       cg Cg        cg        cg Cg        gc        gc T  g       cg        cg A  c       cg        gt Cg        gc        gt Ta        gt        at                         ttctttgtatagtggtcgagcagggcccttgcgcccccgccgcagtcgccgtccgacgacgcgtccctgaccctgaagggccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1253 Hemolysins and related proteins containing CBS domains ... can be seen here     ..................................................................................................................